Basic Statistics
| Measure | Value |
|---|---|
| Filename | SRR1512978_2.fastq.gz |
| File type | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 |
| Total Sequences | 2357249 |
| Sequences flagged as poor quality | 0 |
| Sequence length | 25 |
| %GC | 46 |
Per base sequence quality
Per tile sequence quality
Per sequence quality scores
Per base sequence content
Per sequence GC content
Per base N content
Sequence Length Distribution
Sequence Duplication Levels
Overrepresented sequences
| Sequence | Count | Percentage | Possible Source |
|---|---|---|---|
| GTATCAACGCAGAGTACTTTTTTTT | 2954 | 0.1253155691231601 | No Hit |
Adapter Content
Kmer Content
| Sequence | Count | PValue | Obs/Exp Max | Max Obs/Exp Position |
|---|---|---|---|---|
| GGTATCA | 950 | 0.0 | 12.334742 | 1 |
| GTATTAG | 255 | 0.0 | 12.328842 | 1 |
| TCCAACG | 105 | 2.712477E-7 | 11.765073 | 18 |
| GACGTGA | 455 | 0.0 | 11.267952 | 7 |
| TAATACT | 290 | 0.0 | 11.135019 | 4 |
| TAGGACC | 465 | 0.0 | 11.029374 | 4 |
| TAGGACG | 975 | 0.0 | 10.617738 | 4 |
| GGACGTG | 955 | 0.0 | 10.438752 | 6 |
| AGGACGT | 975 | 0.0 | 10.422695 | 5 |
| TGTAGGA | 1225 | 0.0 | 10.389341 | 2 |
| ACGTGAA | 565 | 0.0 | 10.251128 | 8 |
| GTAGGAC | 1115 | 0.0 | 10.221542 | 3 |
| CGTGAAA | 570 | 0.0 | 10.161421 | 9 |
| AACACCG | 85 | 6.6127954E-4 | 10.055981 | 5 |
| GTCCTAA | 570 | 0.0 | 10.028246 | 1 |
| GTCCTAC | 1060 | 0.0 | 9.79646 | 1 |
| TTAGGAC | 650 | 0.0 | 9.789748 | 3 |
| GTATCAA | 1830 | 0.0 | 9.787129 | 1 |
| CTGTAGG | 1270 | 0.0 | 9.601849 | 1 |
| ATTATAC | 260 | 0.0 | 9.497517 | 3 |